Late leaf spot (Phaeoisariopsis personata infection)

Trait Symbol: Late leaf spot

Page Contributors: PeanutBase

Major Information Sources:


• IPAHM103
• PM384

Background Information: Reaction to Late Leaf Spot (LLS) is caused by the fungus Phaeoisariopsis personata. Late leaf spot (LLS) is a major foliar disease that reduces the pod yield and severely affects the fodder and seed quality in groundnut.

Trait Details: TO:0000439
Trait synonyms: Fungal disease resistance, LLS res, Late Leaf Spot resistance (Phaeoisariopsis personata) The organism was previously known as Cercospora personata, Cercosporidium personatum, and Mycosphaerella berkeleyi.

Late leaf spot (LLS) and rust are two major foliar diseases of peanut that often occur together leading to 50–70% yield loss in the crop. The symptoms of LLS are circular and darker spots appear on the lower surface of the leaves and also forms in stems and pegs resulting in severe yield loss to the groundnut growers. LLS also has an adverse influence on seed quality as well as on quality of haulms. The regular incidence of the above disease under late sown conditions warrants the development of resistant cultivars in groundnut. Though there are many chemical control methods available, development of disease resistant varieties is the best way to control the disease to improve production quality and reduce the adverse effects of chemicals on our ecosystem.

 

Image source: http://www.peanut.ncsu.edu/Diseases/Early_and_Late_Leaf_Spot.aspx

Markers for MAS:

Marker IPAHM103
Source Khedikar, Gowda et al., 2010
Comments "* IPAHM 103 was strongly associated with resistance in the majority of cases (hybrid derivatives from NcAcs, interspecific derivatives, mutant lines) except in few (VR 5, MN 1-28, Girnar 1, ICGV 86590, ICGV 87921, ICGV 86156) germplasm lines." (Khedikar, Gowda et al., 2010)
Type SSR
Repeat (CA)3(GA)17
Forward primer GCATTCACCACCATAGTCCA
Reverse primer TCCTCTGACTTTCCTCCATCA
Size (bp) in susceptible lines 160
Size (bp) in resistant lines ~140

Genotypes:

Accession Susceptibility Aallele Pedigree Plant type Accession source
TAG 24 Susceptible A
R8808 Susceptible A ICGS 11× Chico Spanish bunch ICRISAT
Dh 40 Susceptible A Dh 3-30 × TGE 2 Spanish bunch ICRISAT
K 134 Susceptible A Kadiri 3 × JL 24 Spanish bunch ICRISAT
TG 41 Susceptible A TG 28 × TG 22 Spanish bunch ICRISAT
KRG 1 Susceptible A Selection from Argentina Spanish bunch ICRISAT
TMV 2 Susceptible A Mass selction “Gudhiatham Bunch” Spanish bunch ICRISAT
JL 24 Susceptible A Selection from EC 94943 Spanish bunch ICRISAT
Dh 8 Susceptible A Selection from RS 144 Spanish bunch ICRISAT
DH 43 Susceptible A Mardur local Virginia runner ICRISAT
Chitra Susceptible A Spanish 5B-1 × EC 1688 Virginia runner ICRISAT
R 9227 Susceptible A (ICGS 7 × NC Ac 2214) × ICGV 86031 Spanish bunch NC Ac derived
ICGV 86031 Susceptible A F 334 A-B-14 × NC Ac 2214 Spanish bunch NC Ac derived
R 9214 Susceptible A (ICGS 7 × NC Ac 2214) × ICGV 86031 Spanish bunch NC Ac derived
ICGV 91180 Susceptible A [(TMV 2 × FSB 7-2) × NC Ac 2232) × (F 334 A-B-14 × NC Ac 2214)] Virginia bunch NC Ac derived
ICGV 99004 Susceptible A TMV 2 × ( A. hypogaea × A. cardenasii) Spanish bunch interspecific
ICGV 99001 Susceptible A Robut 33-1 × A. villosa Virginia bunch interspecific
GPBD 4 Resistant B Spanish bunch
ICGV 93008 Resistant B [(Mani Pintar × (Robut 33-1 × NC Ac 2232)] × ICG 2320 Virginia bunch NC Ac derived
ICGV 90266 Resistant B [((J 11 × (M 13 × NC Ac 2214)) × ICG 2271] Virginia bunch NC Ac derived
R 8972 Resistant B ICGS 59 × NC Ac 2240 Spanish bunch NC Ac derived
ICGV 87264 Resistant B Manfredi × NC Ac 17133RF Spanish bunch NC Ac derived
Dh 73 Resistant B Dh 3-30 × ICGV 87264 Spanish bunch NC Ac derived
ICGV 92188 Resistant B [(Robut 33-1 × (M 13 × NC Ac 2214)] × JL 24 Virginia bunch NC Ac derived
ICGV 93023 Resistant B [(Robut 33-1 × NC Ac 2214) × Cyto 213-2] Virginia bunch NC Ac derived
ICGV 87807 Resistant B [(MK 374 × Robut 33-1) × FESR 2 VL NC Ac derived
ICGV 91177 Resistant B (F 334 A-B-14 × NC Ac 2232) × ((TMV 7 × FSB 7-2) × NC Ac 2214) Virginia bunch NC Ac derived
D 39d (Purple & large) Resistant B KRG 1 × CS 16 (ICGV 86855) Spanish bunch interspecific
D 39d (Purple & small) Resistant B KRG 1 × CS 16 (ICGV 86855) Spanish bunch interspecific
B 37c Resistant B JL 24 × ICGV 87165 Spanish bunch interspecific
A 30b Resistant B KRG 1 × ICGV 87165 Virginia bunch interspecific
ICGV 88256 Resistant B (CS 9 × (Robut 33-1 × NC Ac 316) Virginia bunch interspecific
MG 8 Resistant B Mutant 45 × GBFDS 272 Spanish bunch interspecific
GBFDS 272 Resistant B (A. hypogaea × A. caredenasii) Virginia bunch interspecific
JG Thin shell Resistant B JL 24 × GBFDS 272 Spanish bunch interspecific
ICG 99005 Resistant B TMV 2 × (A. hypogaea × A. batizocoi × A duranensis) Virginia bunch interspecific

aAllele: A = allele present in TAG 24 genotype (susceptible to rust) and B = allele present in GPBD 4 genotype (resistant to rust)
NC Ac derived: derived from accession from North Carolina germplasm

Marker PM384
Source Shoba, Manivannan et al., 2012
Comments "While validating the three primers over a set of resistant and susceptible genotypes, the primer PM 384100 allele had association with resistance. Hence PM 384 could be utilized in the marker assisted breeding programme over a wide range of genetic background." (Shoba, Manivannan et al., 2012)
Type SSR
Repeat
Forward primer GGCGTGCCAATAGAGGTTTA
Reverse primer TGAAAACCAACAAGTTTAGTCTCTCT
Size (bp) in susceptible lines
Size (bp) in resistant lines

Genotypes:

Accession Susceptibility Aallele Pedigree Plant type Accession source
COG 0437 Resistant A Virginia bunch ICRISAT
TMV 2 Susceptible A mass selection from Gudiatham bunch (AH 32) and COG 0437 originated from the cross CO 2 × ICGV 94118 Spanish bunch ICRISAT

Links: